주메뉴 바로가기 본문 바로가기 페이지하단 바로가기

중고장터

Scotts Winterguard

페이지 정보

작성자 GilbertTef 조회 2,232회 작성일 24-03-25 04:41

본문

In three female strains Moby Dick, Space Queen and Copenhagen Kush- primers S22645strt 5 CCAATAACCCTCATCCCATTCC3 and S22645end 5 ATTTCCAAAAGTGTGCGATTCC3 were used to amplify beyond the region of the female 540 bp band. It requires patience, persistence and knowledge of both types of weeds and the weapons you have to eradicate them. All of our feminized weed seeds fall under two subspecies indica and sativa.  Source: [url=https://www.emgmanagement.it/2013/06/11/cannabis-chronicles-the-seed-buying-saga/]https://www.emgmanagement.it/2013/06/11/cannabis-chronicles-the-seed-buying-saga/[/url]